pLenti-PGK-CXCR4 (neo)
(Plasmid
#192077)
-
PurposeLentivirus for expression of CXCR4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLENTI PGK Neo DEST
-
Backbone manufacturerEric Campeau & Paul Kaufman (Addgene plasmid # 19067)
- Backbone size w/o insert (bp) 8150
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCXCR4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1149
-
Entrez GeneCXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
- Promoter hPGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pL-PGKneo-seqF1 ctcgttgaccgaatcaccga
- 3′ sequencing primer pL-PGKneo-seqR1 caatagcatgatacaaaggcat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe CXCR4 cDNA was obtained from plasmid pDONR223_CXCR4_WT addgene-plasmid-81957-sequence-169036 via Gateway cloning.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CXCR4 cDNA encodes a number of undefined amino-acids at its C-terminus, as the cDNA donor plasmid pDONR223_CXCR4_WT does not contain a stop codon.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-CXCR4 (neo) was a gift from Roland Friedel (Addgene plasmid # 192077 ; http://n2t.net/addgene:192077 ; RRID:Addgene_192077)