Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-PGK-CXCR4 (neo)
(Plasmid #192077)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192077 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLENTI PGK Neo DEST
  • Backbone manufacturer
    Eric Campeau & Paul Kaufman (Addgene plasmid # 19067)
  • Backbone size w/o insert (bp) 8150
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CXCR4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1149
  • Entrez Gene
    CXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
  • Promoter hPGK

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pL-PGKneo-seqF1 ctcgttgaccgaatcaccga
  • 3′ sequencing primer pL-PGKneo-seqR1 caatagcatgatacaaaggcat
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The CXCR4 cDNA was obtained from plasmid pDONR223_CXCR4_WT addgene-plasmid-81957-sequence-169036 via Gateway cloning.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The CXCR4 cDNA encodes a number of undefined amino-acids at its C-terminus, as the cDNA donor plasmid pDONR223_CXCR4_WT does not contain a stop codon.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-CXCR4 (neo) was a gift from Roland Friedel (Addgene plasmid # 192077 ; http://n2t.net/addgene:192077 ; RRID:Addgene_192077)