pLenti-PGK-NXPH4 (neo)
(Plasmid #192078)

• Purpose: Lentivirus for expression of NXPH4
• Depositing Lab: Roland Friedel
• Publication: Lentiviral vectors for functional studies in GBM cells (unpublished)

Backbone

• Vector backbone: pLENTI PGK Neo DEST
• Backbone manufacturer: Eric Campeau & Paul Kaufman (Addgene plasmid # 19067)
• Backbone size w/o insert (bp): 8150
• Total vector size (bp): 9046
• Vector type: Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NXPH4
• Species: H. sapiens (human)
• Insert Size (bp): 927
• Entrez Gene: NXPH4 (a.k.a. NPH4)
• Promoter: hPGK

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pL-PGKneo-seqF1 ctcgttgaccgaatcaccga
• 3′ sequencing primer: pL-PGKneo-seqR1 caatagcatgatacaaaggcat

Resource Information

• Supplemental Documents:
  • pLenti-PGK-NXPH4 (neo).gbk
• A portion of this plasmid was derived from a plasmid made by: The NXPH4 cDNA was obtained from plasmid NXPH4_OHu107272C_pGenDONR from Genscript via Gateway cloning.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry