pLenti-PGK-NXPH4 (neo)
(Plasmid
#192078)
-
PurposeLentivirus for expression of NXPH4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192078 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLENTI PGK Neo DEST
-
Backbone manufacturerEric Campeau & Paul Kaufman (Addgene plasmid # 19067)
- Backbone size w/o insert (bp) 8150
- Total vector size (bp) 9046
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNXPH4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)927
-
Entrez GeneNXPH4 (a.k.a. NPH4)
- Promoter hPGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pL-PGKneo-seqF1 ctcgttgaccgaatcaccga
- 3′ sequencing primer pL-PGKneo-seqR1 caatagcatgatacaaaggcat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe NXPH4 cDNA was obtained from plasmid NXPH4_OHu107272C_pGenDONR from Genscript via Gateway cloning.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-NXPH4 (neo) was a gift from Roland Friedel (Addgene plasmid # 192078 ; http://n2t.net/addgene:192078 ; RRID:Addgene_192078)