Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


pHR-OFF VIPER CAR (anti-CD19)-candidate design(d+iii)
(Plasmid #192124)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192124 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone size w/o insert (bp) 8440
  • Total vector size (bp) 12367
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-OFF VIPER CAR (anti-CD19)-candidate design(d+iii) was a gift from Wilson Wong (Addgene plasmid # 192124 ; ; RRID:Addgene_192124)
  • For your References section:

    High-performance multiplex drug-gated CAR circuits. Li HS, Wong NM, Tague E, Ngo JT, Khalil AS, Wong WW. Cancer Cell. 2022 Aug 26. pii: S1535-6108(22)00372-5. doi: 10.1016/j.ccell.2022.08.008. 10.1016/j.ccell.2022.08.008 PubMed 36084652