Skip to main content

pX2-IFl_Con-IFr
(Plasmid #192217)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192217 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Total vector size (bp) 2976
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    I-F leader and I-F repeat construct not studied further in this paper (X2)
  • Species
    Synthetic
  • Insert Size (bp)
    300

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.05.26.542337 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX2-IFl_Con-IFr was a gift from Blake Wiedenheft (Addgene plasmid # 192217 ; http://n2t.net/addgene:192217 ; RRID:Addgene_192217)
  • For your References section:

    Structure reveals why genome folding is necessary for site-specific integration of foreign DNA into CRISPR arrays. Santiago-Frangos A, Henriques WS, Wiegand T, Gauvin CC, Buyukyoruk M, Graham AB, Wilkinson RA, Triem L, Neselu K, Eng ET, Lander GC, Wiedenheft B. Nat Struct Mol Biol. 2023 Nov;30(11):1675-1685. doi: 10.1038/s41594-023-01097-2. Epub 2023 Sep 14. 10.1038/s41594-023-01097-2 PubMed 37710013