pCMV-HA Set1
(Plasmid
#192219)
-
PurposeIt expresses HA-fused mouse Set1 isoform protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-HA-N
-
Backbone manufacturerTAKARA
- Backbone size w/o insert (bp) 3782
- Total vector size (bp) 4580
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsnot specialized
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSet isoform 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)870
-
GenBank IDNM023871
-
Entrez GeneSet (a.k.a. 2610030F17Rik, 5730420M11Rik, I-2PP2A, StF-IT-1, TAF-I)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCCCGAAGCGGCAGTCTGCGAT
- 3′ sequencing primer CTAATCATCCTCGCCTTCGTCCTCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA Set1 was a gift from Hisakazu Ogita (Addgene plasmid # 192219 ; http://n2t.net/addgene:192219 ; RRID:Addgene_192219) -
For your References section:
Vascular smooth muscle RhoA counteracts abdominal aortic aneurysm formation by modulating MAP4K4 activity. Molla MR, Shimizu A, Komeno M, Rahman NIA, Soh JEC, Nguyen LKC, Khan MR, Tesega WW, Chen S, Pang X, Tanaka-Okamoto M, Takashima N, Sato A, Suzuki T, Ogita H. Commun Biol. 2022 Oct 7;5(1):1071. doi: 10.1038/s42003-022-04042-z. 10.1038/s42003-022-04042-z PubMed 36207400