pSV40_mD6Ertd527e-HA
(Plasmid
#192222)
-
PurposeExpresses HA-tagged murine D6Ertd527e gene in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSV40
- Backbone size w/o insert (bp) 2886
- Total vector size (bp) 4275
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemD6Ertd527e
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1389
-
GenBank IDGene ID: 52372 NR_176826.1
-
Entrez GeneD6Ertd527e
- Promoter SV40
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EagI,NotI (not destroyed)
- 5′ sequencing primer cattctccgccccatggctg
- 3′ sequencing primer AGCAATAGCATCACAAATTTCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSV40_mD6Ertd527e-HA was a gift from Petr Svoboda (Addgene plasmid # 192222 ; http://n2t.net/addgene:192222 ; RRID:Addgene_192222) -
For your References section:
De novo emergence, existence, and demise of a protein-coding gene in murids. Petrzilek J, Pasulka J, Malik R, Horvat F, Kataruka S, Fulka H, Svoboda P. BMC Biol. 2022 Dec 8;20(1):272. doi: 10.1186/s12915-022-01470-5. 10.1186/s12915-022-01470-5 PubMed 36482406