eIF3b sgRNA-2 PX459 plasmid
(Plasmid
#192250)
-
Purposeexpressing sgRNA-2 targeting eIF3b locus closed to stop coden
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePx459VQR(Plasmid #101718)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-2 targeting eIF3b locus closed to stop coden
-
gRNA/shRNA sequenceATCATTCCCCTCGGGAATCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneEIF3B (a.k.a. EIF3-ETA, EIF3-P110, EIF3-P116, EIF3S9, PRT1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer hU6-F_GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.08.28.505560v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eIF3b sgRNA-2 PX459 plasmid was a gift from Dieter Wolf (Addgene plasmid # 192250 ; http://n2t.net/addgene:192250 ; RRID:Addgene_192250) -
For your References section:
eIF3 mRNA selectivity profiling reveals eIF3k as a cancer-relevant regulator of ribosome content. Duan H, Zhang S, Zarai Y, Ollinger R, Wu Y, Sun L, Hu C, He Y, Tian G, Rad R, Kong X, Cheng Y, Tuller T, Wolf DA. EMBO J. 2023 Jun 15;42(12):e112362. doi: 10.15252/embj.2022112362. Epub 2023 May 8. 10.15252/embj.2022112362 PubMed 37155573