etnppl-pGEMtEasy
(Plasmid
#192263)
-
PurposeMouse Etnppl sequence is inserted in pGEM-T Easy vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM-T Easy Vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3015
- Total vector size (bp) 4683
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameethanolamine phosphate phospholyase
-
Alt nameEtnppl
-
Alt nameAgxt2l1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1668
-
GenBank IDNM_027907.3
-
Entrez GeneEtnppl (a.k.a. 1300019H02Rik, Agxt2l1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTTGTAAAACGACGGCCAGT
- 3′ sequencing primer GGAAACAGCTATGACCATGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
etnppl-pGEMtEasy was a gift from Toshihide Yamashita (Addgene plasmid # 192263 ; http://n2t.net/addgene:192263 ; RRID:Addgene_192263) -
For your References section:
Utilization of ethanolamine phosphate phospholyase as a unique astrocytic marker. Tsujioka H, Yamashita T. Front Cell Neurosci. 2023 Jan 30;17:1097512. doi: 10.3389/fncel.2023.1097512. eCollection 2023. 10.3389/fncel.2023.1097512 PubMed 36794261