Skip to main content

CCR5_gRNA_pX459
(Plasmid #192268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCR5 guide RNA
  • gRNA/shRNA sequence
    GGAGAGCTTGGCTCTGTTGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 3′ sequencing primer cgtaagttatgtaacgggtacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CCR5_gRNA_pX459 was a gift from Shantanu Chowdhury (Addgene plasmid # 192268 ; http://n2t.net/addgene:192268 ; RRID:Addgene_192268)
  • For your References section:

    Human telomerase is directly regulated by non-telomeric TRF2-G-quadruplex interaction. Sharma S, Mukherjee AK, Roy SS, Bagri S, Lier S, Verma M, Sengupta A, Kumar M, Nesse G, Pandey DP, Chowdhury S. Cell Rep. 2021 May 18;35(7):109154. doi: 10.1016/j.celrep.2021.109154. 10.1016/j.celrep.2021.109154 PubMed 34010660