Skip to main content

TERTp124_Gluc_CCR5
(Plasmid #192271)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192271 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AY10_pS.Donor.R5.TS
  • Backbone manufacturer
    Manuel A.F.V. Goncalves
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter Reporter Insert within donor template
  • Alt name
    Gaussia luciferase reporter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1309
  • Mutation
    -124 C to T
  • Promoter TERT promoter driving expression of gaussia

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TTTTGGCAGGGCTCCGATGTAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TERTp124_Gluc_CCR5 was a gift from Shantanu Chowdhury (Addgene plasmid # 192271 ; http://n2t.net/addgene:192271 ; RRID:Addgene_192271)
  • For your References section:

    Human telomerase is directly regulated by non-telomeric TRF2-G-quadruplex interaction. Sharma S, Mukherjee AK, Roy SS, Bagri S, Lier S, Verma M, Sengupta A, Kumar M, Nesse G, Pandey DP, Chowdhury S. Cell Rep. 2021 May 18;35(7):109154. doi: 10.1016/j.celrep.2021.109154. 10.1016/j.celrep.2021.109154 PubMed 34010660