tet pLKO.1-shCLTC v1 puro
(Plasmid
#192347)
-
PurposeLentiviral expression vector for an inducible shCLTC v1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonetet pLKO.1 puro
-
Backbone manufacturerAddgene #21915
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshCLTC v1
-
gRNA/shRNA sequenceACACTCGTGCAGTCAATTATT
-
SpeciesH. sapiens (human)
-
Entrez GeneCLTC (a.k.a. CHC, CHC17, CLH-17, CLTCL2, Hc, MRD56)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet pLKO.1-shCLTC v1 puro was a gift from Kevin Janes (Addgene plasmid # 192347 ; http://n2t.net/addgene:192347 ; RRID:Addgene_192347) -
For your References section:
Nucleocytoplasmic transport of active HER2 causes fractional escape from the DCIS-like state. Wang L, Paudel BB, McKnight RA, Janes KA. Nat Commun. 2023 Apr 13;14(1):2110. doi: 10.1038/s41467-023-37914-x. 10.1038/s41467-023-37914-x PubMed 37055441