Skip to main content

TL024_lenti_hSyn:HaloTag-GluA1
(Plasmid #192517)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192517 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FSYN
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 12216
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HaloTag-GluA1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3702
  • Promoter hSyn
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hSyn-F: CAGCCGGACCGCACCACGCG
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TL024_lenti_hSyn:HaloTag-GluA1 was a gift from Adam Cohen (Addgene plasmid # 192517 ; http://n2t.net/addgene:192517 ; RRID:Addgene_192517)
  • For your References section:

    Mapping memories: pulse-chase labeling reveals AMPA receptor dynamics during memory formation. Kim D, Park P, Li X, Wong Campos JD, Tian H, Moult EM, Grimm JB, Lavis L, Cohen AE. bioRxiv. 2023 May 29:2023.05.26.541296. doi: 10.1101/2023.05.26.541296. Preprint. 10.1101/2023.05.26.541296 PubMed 37292614
Commonly requested with: