Skip to main content

2x GCN4-LgBiT
(Plasmid #192542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192542 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 2446
  • Total vector size (bp) 8155
  • Modifications to backbone
    Addition of AAVS1 homology arms and p2a-PURO resistance gene
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2x GCN4-LgBiT
  • Insert Size (bp)
    1521
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctaccggtcgccacctctagaatggccttaccagtgaccgc
  • 3′ sequencing primer AACTGGGGCACAAGCTTAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The 2x GCN4 fragment was amplified from Addgene plasmid 60910

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2x GCN4-LgBiT was a gift from Jennifer Prescher (Addgene plasmid # 192542 ; http://n2t.net/addgene:192542 ; RRID:Addgene_192542)
  • For your References section:

    Generalized Bioluminescent Platform To Observe and Track Cellular Interactions. Ng KK, Prescher JA. Bioconjug Chem. 2022 Oct 19;33(10):1876-1884. doi: 10.1021/acs.bioconjchem.2c00348. Epub 2022 Sep 27. 10.1021/acs.bioconjchem.2c00348 PubMed 36166258