2x GCN4-LgBiT
(Plasmid
#192542)
-
PurposeExpresses receiver cell components of LOTIIS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 2446
- Total vector size (bp) 8155
-
Modifications to backboneAddition of AAVS1 homology arms and p2a-PURO resistance gene
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2x GCN4-LgBiT
-
Insert Size (bp)1521
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctaccggtcgccacctctagaatggccttaccagtgaccgc
- 3′ sequencing primer AACTGGGGCACAAGCTTAAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe 2x GCN4 fragment was amplified from Addgene plasmid 60910
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2x GCN4-LgBiT was a gift from Jennifer Prescher (Addgene plasmid # 192542 ; http://n2t.net/addgene:192542 ; RRID:Addgene_192542) -
For your References section:
Generalized Bioluminescent Platform To Observe and Track Cellular Interactions. Ng KK, Prescher JA. Bioconjug Chem. 2022 Oct 19;33(10):1876-1884. doi: 10.1021/acs.bioconjchem.2c00348. Epub 2022 Sep 27. 10.1021/acs.bioconjchem.2c00348 PubMed 36166258