pENTR4 Ta-sro1 WWE-PARP
(Plasmid
#192548)
-
PurposepENTR plasmid Triticum aestivum sro1, amino acids 1-434, cultivar SR3, no stop codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR4
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 2249
- Total vector size (bp) 3551
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
-
Alt nameTa-sro1
-
Alt nameWWE-PARP fragment
-
Alt nameTrp-Trp-Glu, poly(ADP-ribose) polymerase
-
SpeciesTriticum aestivum
-
Insert Size (bp)1302
-
GenBank IDAEK94072
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCGCCATAAACTGCCAGG
- 3′ sequencing primer CGTTGAATATGGCTCATAACACCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bygene synthesis based on sequence information from Liu et al. 2004, PMID 24443520
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR4 Ta-sro1 WWE-PARP was a gift from Lennart Wirthmueller (Addgene plasmid # 192548 ; http://n2t.net/addgene:192548 ; RRID:Addgene_192548) -
For your References section:
The superior salinity tolerance of bread wheat cultivar Shanrong No. 3 is unlikely to be caused by elevated Ta-sro1 poly-(ADP-ribose) polymerase activity. Vogt S, Feijs K, Hosch S, De Masi R, Lintermann R, Loll B, Wirthmueller L. Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261. 10.1093/plcell/koac261 PubMed 35980152