Skip to main content

pENTR4 Ta-sro1 WWE-PARP
(Plasmid #192548)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192548 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR4
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 2249
  • Total vector size (bp) 3551
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
  • Alt name
    Ta-sro1
  • Alt name
    WWE-PARP fragment
  • Alt name
    Trp-Trp-Glu, poly(ADP-ribose) polymerase
  • Species
    Triticum aestivum
  • Insert Size (bp)
    1302
  • GenBank ID
    AEK94072

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCGCCATAAACTGCCAGG
  • 3′ sequencing primer CGTTGAATATGGCTCATAACACCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gene synthesis based on sequence information from Liu et al. 2004, PMID 24443520

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR4 Ta-sro1 WWE-PARP was a gift from Lennart Wirthmueller (Addgene plasmid # 192548 ; http://n2t.net/addgene:192548 ; RRID:Addgene_192548)
  • For your References section:

    The superior salinity tolerance of bread wheat cultivar Shanrong No. 3 is unlikely to be caused by elevated Ta-sro1 poly-(ADP-ribose) polymerase activity. Vogt S, Feijs K, Hosch S, De Masi R, Lintermann R, Loll B, Wirthmueller L. Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261. 10.1093/plcell/koac261 PubMed 35980152