pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL
(Plasmid
#192602)
-
PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepOTTC1470 - pAAV CaMKII iRFP-FLAG
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 5438
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSERCaMP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)594
- Promoter CaMKII
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CaMKII-Forward CGTCAGTCAAGCCGGTTCTC
- 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNIDA GEVVC
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL was a gift from Brandon Harvey (Addgene plasmid # 192602 ; http://n2t.net/addgene:192602 ; RRID:Addgene_192602)