lentiCRISPRv2_ZsG gRNA_4
(Plasmid
#192688)
-
PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9, ZsGreen targeting sgRNA #4
-
gRNA/shRNA sequenceGCGCTCCTTCCTGTTCGAGGA
-
SpeciesSynthetic
- Promoter EF1a, U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2_ZsG gRNA_4 was a gift from Jeffrey Miner (Addgene plasmid # 192688 ; http://n2t.net/addgene:192688 ; RRID:Addgene_192688)