Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDONR221-kcnj6
(Plasmid #192725)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192725 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR221
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Gateway Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    kcnj6
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1257
  • Mutation
    5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6
  • Entrez Gene
    kcnj6
  • Promoter None

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

cDNA encodes homolog of human KCNJ6

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR221-kcnj6 was a gift from Summer Thyme (Addgene plasmid # 192725 ; http://n2t.net/addgene:192725 ; RRID:Addgene_192725)