pLN-AIDA-Tyr1
(Plasmid
#192831)
-
PurposeIPTG inducible AIDA-Tyrosinase expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLN4
-
Backbone manufacturerAnton Kan
- Backbone size w/o insert (bp) 5198
- Total vector size (bp) 7841
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAIDA-Tyr1
-
Alt nameAIDA fused to Tyrosinase 1
-
SpeciesSynthetic; Bacillus megaterium
-
Insert Size (bp)2649
- Promoter pL-lac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTGAACGCTCTCTACTAGAGTCAC
- 3′ sequencing primer GCCTCTTTTCTGGAATTTGGTACCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe AIDA gene was originally obtained from pAIDA (Addgene plasmid #79180)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLN-AIDA-Tyr1 was a gift from André Studart (Addgene plasmid # 192831 ; http://n2t.net/addgene:192831 ; RRID:Addgene_192831) -
For your References section:
Complex Living Materials made by Light-based Printing of Genetically Programmed Bacteria. Binelli MR, Kan A, Rozas LEA, Pisaturo G, Prakash N, Studart AR. Adv Mater. 2022 Nov 29:e2207483. doi: 10.1002/adma.202207483. 10.1002/adma.202207483 PubMed 36444840