pPRC
(Plasmid
#192855)
-
Purpose(Empty Backbone) Cloning of promoter of interest in front of mkate2 reporter gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPRC
-
Backbone manufacturerAmber Bernauw, Indra Bervoets
- Backbone size (bp) 3186
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter no promoter
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCCAGATAGCCCAGTAGCTGACATTC
- 3′ sequencing primer GTGGTTATTCACGGTGCCTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPRC was a gift from Eveline Peeters (Addgene plasmid # 192855 ; http://n2t.net/addgene:192855 ; RRID:Addgene_192855) -
For your References section:
In Vivo Screening Method for the Identification and Characterization of Prokaryotic, Metabolite-Responsive Transcription Factors. Bernauw AJ, De Kock V, Bervoets I. Methods Mol Biol. 2022;2516:113-141. doi: 10.1007/978-1-0716-2413-5_8. 10.1007/978-1-0716-2413-5_8 PubMed 35922625