pITC
(Plasmid
#192856)
-
Purpose(Empty Backbone) Cloning and expression of transcription factor gene under control of naringenin inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepITC
-
Backbone manufacturerAmber Bernauw, Indra Bervoets
- Backbone size (bp) 4917
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter PfdeAR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAGCCTGGCCATGACAACG
- 3′ sequencing primer TGACCACTTCGGATTATCCCGTGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pITC was a gift from Eveline Peeters (Addgene plasmid # 192856 ; http://n2t.net/addgene:192856 ; RRID:Addgene_192856) -
For your References section:
In Vivo Screening Method for the Identification and Characterization of Prokaryotic, Metabolite-Responsive Transcription Factors. Bernauw AJ, De Kock V, Bervoets I. Methods Mol Biol. 2022;2516:113-141. doi: 10.1007/978-1-0716-2413-5_8. 10.1007/978-1-0716-2413-5_8 PubMed 35922625