Skip to main content
Addgene

pITC
(Plasmid #192856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192856 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pITC
  • Backbone manufacturer
    Amber Bernauw, Indra Bervoets
  • Backbone size (bp) 4917
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Promoter PfdeAR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGAGCCTGGCCATGACAACG
  • 3′ sequencing primer TGACCACTTCGGATTATCCCGTGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pITC was a gift from Eveline Peeters (Addgene plasmid # 192856 ; http://n2t.net/addgene:192856 ; RRID:Addgene_192856)
  • For your References section:

    In Vivo Screening Method for the Identification and Characterization of Prokaryotic, Metabolite-Responsive Transcription Factors. Bernauw AJ, De Kock V, Bervoets I. Methods Mol Biol. 2022;2516:113-141. doi: 10.1007/978-1-0716-2413-5_8. 10.1007/978-1-0716-2413-5_8 PubMed 35922625