pAd-PR.Cre
(Plasmid
#192936)
-
PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1 and Cre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAd/PL-Dest
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 34864
- Total vector size (bp) 35583
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTrp53
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2349
-
Entrez GeneTrp53 (a.k.a. Tp53, bbl, bfy, bhy, p44, p53)
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
- 3′ sequencing primer CAATGCTGGAGCCCATCACAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRb1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2349
-
Entrez GeneRb1 (a.k.a. Rb, Rb-1, p110-RB1, pRb, pp105)
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
- 3′ sequencing primer CAATGCTGGAGCCCATCACAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd-PR.Cre was a gift from Thorsten Stiewe (Addgene plasmid # 192936 ; http://n2t.net/addgene:192936 ; RRID:Addgene_192936) -
For your References section:
Monitoring autochthonous lung tumors induced by somatic CRISPR gene editing in mice using a secreted luciferase. Merle N, Elmshauser S, Strassheimer F, Wanzel M, Konig AM, Funk J, Neumann M, Kochhan K, Helmprobst F, Pagenstecher A, Nist A, Mernberger M, Schneider A, Braun T, Borggrefe T, Savai R, Timofeev O, Stiewe T. Mol Cancer. 2022 Oct 3;21(1):191. doi: 10.1186/s12943-022-01661-2. 10.1186/s12943-022-01661-2 PubMed 36192757