Skip to main content

MSCV-ASNS-OE-IRES-Thy1.1
(Plasmid #192947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192947 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV-IRES-Thy1.1
  • Backbone size w/o insert (bp) 6221
  • Total vector size (bp) 7907
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Thy1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Asparagine synthetase
  • Alt name
    Asns
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1686
  • Entrez Gene
    Asns
  • Promoter 5'LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCCTTTGTACACCCTAAGCCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-ASNS-OE-IRES-Thy1.1 was a gift from Ping-Chih Ho (Addgene plasmid # 192947 ; http://n2t.net/addgene:192947 ; RRID:Addgene_192947)
  • For your References section:

    CD8(+) T cell metabolic rewiring defined by scRNA-seq identifies a critical role of ASNS expression dynamics in T cell differentiation. Fernandez-Garcia J, Franco F, Parik S, Altea-Manzano P, Pane AA, Broekaert D, van Elsen J, Vermeire I, Schalley T, Planque M, van Brussel T, Schepers R, Modave E, Karakach TK, Carmeliet P, Lambrechts D, Ho PC, Fendt SM. Cell Rep. 2022 Nov 15;41(7):111639. doi: 10.1016/j.celrep.2022.111639. 10.1016/j.celrep.2022.111639 PubMed 36384124