Skip to main content

pFL-EGFP-3xFlag-Fml1
(Plasmid #193058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193058 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFL-EGFP-3xFlag-DEST
  • Backbone size w/o insert (bp) 8802
  • Total vector size (bp) 2505
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fml1
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
    2514
  • GenBank ID
    2543668
  • Entrez Gene
    fml1 (a.k.a. SPAC9.05)
  • Promoter polyhedron
  • Tag / Fusion Protein
    • 3xFlag (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGGAAACTTAAGCTTATGG
  • 3′ sequencing primer ATCCTCTAGTACTTCTCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFL-EGFP-3xFlag-Fml1 was a gift from Andrew Deans (Addgene plasmid # 193058 ; http://n2t.net/addgene:193058 ; RRID:Addgene_193058)
  • For your References section:

    Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850