Skip to main content
Addgene

pFastBac1-NpSxph
(Plasmid #193097)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193097 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nanorana parkeri saxiphilin
  • Species
    Nanorana parkeri
  • GenBank ID
    XM_018555331.1
  • Promoter polyhedrin
  • Tag / Fusion Protein
    • 3C-eGFP-His10 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CGGGCGCGGATCCCGGTCCG
  • 3′ sequencing primer GCTCTTCGCCCTTAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac1-NpSxph was a gift from Dan Minor (Addgene plasmid # 193097 ; http://n2t.net/addgene:193097 ; RRID:Addgene_193097)
  • For your References section:

    Definition of a saxitoxin (STX) binding code enables discovery and characterization of the anuran saxiphilin family. Chen Z, Zakrzewska S, Hajare HS, Alvarez-Buylla A, Abderemane-Ali F, Bogan M, Ramirez D, O'Connell LA, Du Bois J, Minor DL Jr. Proc Natl Acad Sci U S A. 2022 Nov;119(44):e2210114119. doi: 10.1073/pnas.2210114119. Epub 2022 Oct 24. 10.1073/pnas.2210114119 PubMed 36279441