pCXLE-mCherry-t2a-SOX2AV-p2a-KLF4
(Plasmid #193295)

• Purpose: episomal vector expressing mCherry + human SOX2A61V + KLF4
• Depositing Lab: Hans Schöler
• Publication: MacCarthy et al bioRxiv 2022.09.23.509242

Backbone

• Vector backbone: pCXLE
  (Search Vector Database)
• Backbone size w/o insert (bp): 10180
• Total vector size (bp): 13443
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry-t2a-SOX2AV-p2a-KLF4
• Species: H. sapiens (human); Discosoma
• Insert Size (bp): 3263
• Mutation: SOX2A61V is a highly cooperative point mutant of SOX2
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)
• Entrez Gene: KLF4 (a.k.a. EZF, GKLF)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tctgctaaccatgttcatgccttc
• 3′ sequencing primer: AGGAAGGTCCGCTGGATTGA

Resource Information

• Supplemental Documents:
  • pCXLE-mCherry-t2a-hSOX2AV-p2a-KLF4.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry