pCZGY2748
(Plasmid
#193331)
-
PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr I
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerGoldstein Lab
- Backbone size w/o insert (bp) 8113
- Total vector size (bp) 8133
-
Modifications to backboneInsertion of sgRNA sequence specific to a region of Chromosome I devoid of known coding regions. Cloning was performed using site-directed mutagenesis with the sgRNA being inserted behind the U6 promoter.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for ttTi4348
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)119
- Promoter U6
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer aaggcgcacactctgttttg
- 3′ sequencing primer ggtgtgaaataccgcacaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2748 was a gift from Yishi Jin (Addgene plasmid # 193331 ; http://n2t.net/addgene:193331 ; RRID:Addgene_193331) -
For your References section:
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity. Blazie SM, Takayanagi-Kiya S, McCulloch KA, Jin Y. Elife. 2021 Jul 29;10. pii: 68336. doi: 10.7554/eLife.68336. 10.7554/eLife.68336 PubMed 34323215