pBS-TRE-mRuby3-WPRE
(Plasmid
#193336)
-
PurposeExpresses mRuby3 under the TRE promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript SK(+)
-
Backbone manufacturerStratagene
- Total vector size (bp) 4746
-
Modifications to backboneAn Xho-Xho fragment containing TRE-SV40 poly A was transferred from pTRE-Tight (Clontech). WPRE was also inserted between a NotI site (not destroyed)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRuby3
-
SpeciesModified fluorescent protein
-
Insert Size (bp)714
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGTCGAGGTAGGCGTGTAC
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mRuby3 gene was cloned from pNCS-mRuby3 (Addgene #74234).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-TRE-mRuby3-WPRE was a gift from Takeshi Imai (Addgene plasmid # 193336 ; http://n2t.net/addgene:193336 ; RRID:Addgene_193336) -
For your References section:
Automated neuronal reconstruction with super-multicolour Tetbow labelling and threshold-based clustering of colour hues. Leiwe MN, Fujimoto S, Baba T, Moriyasu D, Saha B, Sakaguchi R, Inagaki S, Imai T. Nat Commun. 2024 Jun 25;15(1):5279. doi: 10.1038/s41467-024-49455-y. 10.1038/s41467-024-49455-y PubMed 38918382