pAAV-TRE-mNeonGreen-WPRE
(Plasmid
#193341)
-
PurposeAAV-mediated expression of mNeonGreen under the TRE promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Total vector size (bp) 5120
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesModified fluorescent protein
-
Insert Size (bp)711
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCGAGGTAGGCGTGTAC
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mNeonGreen gene was purchased from Allele Biotechnology
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-mNeonGreen-WPRE was a gift from Takeshi Imai (Addgene plasmid # 193341 ; http://n2t.net/addgene:193341 ; RRID:Addgene_193341) -
For your References section:
Automated neuronal reconstruction with super-multicolour Tetbow labelling and threshold-based clustering of colour hues. Leiwe MN, Fujimoto S, Baba T, Moriyasu D, Saha B, Sakaguchi R, Inagaki S, Imai T. Nat Commun. 2024 Jun 25;15(1):5279. doi: 10.1038/s41467-024-49455-y. 10.1038/s41467-024-49455-y PubMed 38918382