pAAV-TRE-YPet-WPRE
(Plasmid
#193342)
-
PurposeAAV-mediated expression of YPet under the TRE promoter in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Total vector size (bp) 5129
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYPet
-
SpeciesModified fluorescent protein
-
Insert Size (bp)720
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCGAGGTAGGCGTGTAC
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe YPet gene was cloned from pCAGGS-RaichuEV-Rac (https://doi.org/10.1091/mbc.e11-01-0072).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-YPet-WPRE was a gift from Takeshi Imai (Addgene plasmid # 193342 ; http://n2t.net/addgene:193342 ; RRID:Addgene_193342) -
For your References section:
Automated reconstruction of neuronal circuits with super-multicolour fluorescence imaging. Leiwe MN, Fujimoto S, Baba T, Moriyasu D, Saha B, Sakaguchi R, Inagaki S, Imai T. bioRxiv 2022.10.20.512984 10.1101/2022.10.20.512984