pHAGE2-TetOminiCMV-Sox2-17-t2a-Klf4
(Plasmid #193348)

• Purpose: tetO-S*K (Dox-inducible reprogramming lentiviral vector expressing mouse super-Sox + Klf4)
• Depositing Lab: Hans Schöler
• Publication: MacCarthy et al bioRxiv 2022.09.23.509242

Backbone

• Vector backbone: pHAGE2
  (Search Vector Database)
• Backbone size w/o insert (bp): 6247
• Total vector size (bp): 8965
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sox2-17-t2a-Klf4
• Alt name: Klf4
• Alt name: superSox
• Species: M. musculus (mouse)
• Insert Size (bp): 2718
• Mutation: Sox2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of Sox2 were swapped with Sox17: 43-47, 61, 65-86 and CTD
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)
• Entrez Gene: Sox2 (a.k.a. Sox-2, lcc, ysb)
• Promoter: TetO mini CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (additional NotI site is present in Sox2-17 sequence) (unknown if destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: gagacgccatccacgctgt
• 3′ sequencing primer: AGGAAGGTCCGCTGGATTGA

Resource Information

• Supplemental Documents:
  • pHAGE2-TetOminiCMV-Sox2-17-t2a-Klf4.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Institut Pasteur Label License for cPPT
• Industry Terms:
  • Not Available to Industry