T7-VEE-CFP-e2a-SOX2AV-p2a-KLF4
(Plasmid #193359)

• Purpose: self-replicating RNA vector expressing CFP + human SOX2A61V + KLF4 + PuroR
• Depositing Lab: Hans Schöler
• Publication: MacCarthy et al bioRxiv 2022.09.23.509242

Backbone

• Vector backbone: T7-VEE-IRES-puro (Addgene plasmid 58970)
  (Search Vector Database)
• Total vector size (bp): 14038
• Vector type: Mammalian Expression ; Venezuelan equine encephalitis (VEE) virus RNA replicon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CFP-e2a-SOX2AV-p2a-KLF4
• Alt name: Cyan Fluorescent Protein
• Alt name: SOX2
• Alt name: KLF4
• Species: H. sapiens (human); Aequorea victoria
• Insert Size (bp): 3267
• Mutation: SOX2A61V is a highly cooperative point mutant of SOX2
• Entrez Gene: KLF4 (a.k.a. EZF, GKLF)
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: CGGCTAACCTGAATGGACTACGAC
• 3′ sequencing primer: TATAGACAAACGCACACCG

Resource Information

• Supplemental Documents:
  • T7-VEE-CFP-e2a-SOX2AV-p2a-KLF4.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry