Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

vgCam-pRSETb
(Plasmid #193362)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSETB
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4900
  • Vector type
    E.coli expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vgCam
  • Alt name
    vgCam
  • Species
    E.coli
  • Insert Size (bp)
    2000
  • Promoter T7
  • Tags / Fusion Proteins
    • His X6 tag (N terminal on insert)
    • Strep tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGATCCCGCGAAATTAATACGAC
  • 3′ sequencing primer GCCTCTTCGCTATTACGCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    vgCam-pRSETb was a gift from Takeharu Nagai (Addgene plasmid # 193362 ; http://n2t.net/addgene:193362 ; RRID:Addgene_193362)
  • For your References section:

    Extension of the short wavelength side of fluorescent proteins using hydrated chromophores, and its application. Sugiura K, Nagai T. Commun Biol. 2022 Nov 3;5(1):1172. doi: 10.1038/s42003-022-04153-7. 10.1038/s42003-022-04153-7 PubMed 36329112