Skip to main content
Addgene
Open Menu

vgCam-pRSETb
(Plasmid #193362)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193362 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 193362-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 193362-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pRSETB
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4900
  • Vector type
    E.coli expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vgCam
  • Alt name
    vgCam
  • Species
    E.coli
  • Insert Size (bp)
    2000
  • Promoter T7
  • Tags / Fusion Proteins
    • His X6 tag (N terminal on insert)
    • Strep tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGATCCCGCGAAATTAATACGAC
  • 3′ sequencing primer GCCTCTTCGCTATTACGCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    vgCam-pRSETb was a gift from Takeharu Nagai (Addgene plasmid # 193362 ; http://n2t.net/addgene:193362 ; RRID:Addgene_193362)

  • For your References section:

    Extension of the short wavelength side of fluorescent proteins using hydrated chromophores, and its application. Sugiura K, Nagai T. Commun Biol. 2022 Nov 3;5(1):1172. doi: 10.1038/s42003-022-04153-7. 10.1038/s42003-022-04153-7 PubMed 36329112
Related items: