UAS-Cre-T2A-miRFP670
(Plasmid
#193581)
-
PurposeFluorescent reporter for Gal4-induced Cre recombination
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUAS-Cre
-
Backbone manufacturerConnie Cepko's lab
- Backbone size w/o insert (bp) 4036
- Total vector size (bp) 5128
-
Modifications to backboneSV40 poly(A) signal was replaced with T2A-miRFP670 and bGH poly(A) signal
-
Vector typeCre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiRFP670
-
Alt nameiRFP670
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)948
-
GenBank IDKX421097.1
- Promoter 5X UAS
-
Tag
/ Fusion Protein
- T2A (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (destroyed during cloning)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer AGAATTCGGCAGTGGAGAGGG
- 3′ sequencing primer AAAAGGTACCTCCCCAGCATGCCTGCTATT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSpCas9 (BB)-2AmiRFP670 was a gift from Ralf Kuehn (Addgene plasmid #91854; http://n2t.net/addgene:91854 ; RRID: Addgene_91854).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UAS-Cre-T2A-miRFP670 was a gift from Satoru Takahashi (Addgene plasmid # 193581 ; http://n2t.net/addgene:193581 ; RRID:Addgene_193581) -
For your References section:
Generation of a Gal4-dependent gene recombination and illuminating mouse. Yoshihara M, Nishino T, Sambe N, Nayakama T, Radtke F, Mizuno S, Takahashi S. Exp Anim. 2022 Aug 5;71(3):385-390. doi: 10.1538/expanim.21-0202. Epub 2022 Apr 21. 10.1538/expanim.21-0202 PubMed 35444103