Skip to main content

VAMP3(S48A)-mCherry
(Plasmid #193635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193635 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VAMP3
  • Alt name
    cellubrevin, synaptobrevin 3
  • Species
    M. musculus (mouse)
  • Mutation
    changed serine 48 to alanine
  • GenBank ID
    NP_033524.1
  • Entrez Gene
    Vamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The wild-type VAMP3 (with S48) is also available at Addgene (VAMP3-mCherry catalog numer 92423)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VAMP3(S48A)-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 193635 ; http://n2t.net/addgene:193635 ; RRID:Addgene_193635)
  • For your References section:

    Phosphorylation of VAMP3 couples IL-6 Exocytosis to dendritic cell activation. Chen T, Psoma A, Mahajan S, Ter Beest M, Linders P, Franciosa G, Bianchi F, Bogaart GVD, Warner H. J Cell Sci. 2025 Sep 22:jcs.264139. doi: 10.1242/jcs.264139. 10.1242/jcs.264139 PubMed 40977280