VAMP3(S48A)-mCherry
(Plasmid
#193635)
-
PurposeExpresses S48A phosphodead VAMP3 fused to mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmCherry-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVAMP3
-
Alt namecellubrevin, synaptobrevin 3
-
SpeciesM. musculus (mouse)
-
Mutationchanged serine 48 to alanine
-
GenBank IDNP_033524.1
-
Entrez GeneVamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer CACCTTGAAGCGCATGAACT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The wild-type VAMP3 (with S48) is also available at Addgene (VAMP3-mCherry catalog numer 92423)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP3(S48A)-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 193635 ; http://n2t.net/addgene:193635 ; RRID:Addgene_193635) -
For your References section:
Phosphorylation of VAMP3 couples IL-6 Exocytosis to dendritic cell activation. Chen T, Psoma A, Mahajan S, Ter Beest M, Linders P, Franciosa G, Bianchi F, Bogaart GVD, Warner H. J Cell Sci. 2025 Sep 22:jcs.264139. doi: 10.1242/jcs.264139. 10.1242/jcs.264139 PubMed 40977280