WDFY2-GFP
(Plasmid
#193636)
-
PurposeExpresses GFP-tagged WDFY2 in mammalian cells
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWDFY2
-
Alt nameWDF2, ZFYVE22
-
SpeciesH. sapiens (human)
-
MutationGFP
-
GenBank IDNM_052950.3
-
Entrez GeneVamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xhol (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WDFY2-GFP was a gift from Geert van den Bogaart (Addgene plasmid # 193636 ; http://n2t.net/addgene:193636 ; RRID:Addgene_193636) -
For your References section:
Phosphorylation of VAMP3 couples IL-6 Exocytosis to dendritic cell activation. Chen T, Psoma A, Mahajan S, Ter Beest M, Linders P, Franciosa G, Bianchi F, Bogaart GVD, Warner H. J Cell Sci. 2025 Sep 22:jcs.264139. doi: 10.1242/jcs.264139. 10.1242/jcs.264139 PubMed 40977280