pMSCV puro PRDM14
(Plasmid
#193677)
-
PurposeConstitutive retroviral expression of PRDM14
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMSCV puro
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePRDM14
-
SpeciesH. sapiens (human)
-
Entrez GenePRDM14 (a.k.a. PFM11)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV puro PRDM14 was a gift from William Hahn (Addgene plasmid # 193677 ; http://n2t.net/addgene:193677 ; RRID:Addgene_193677) -
For your References section:
YAP1 and PRDM14 converge to promote cell survival and tumorigenesis. Kim M, Ly SH, Xie Y, Duronio GN, Ford-Roshon D, Hwang JH, Sulahian R, Rennhack JP, So J, Gjoerup O, Talamas JA, Grandclaudon M, Long HW, Doench JG, Sethi NS, Giannakis M, Hahn WC. Dev Cell. 2022 Jan 24;57(2):212-227.e8. doi: 10.1016/j.devcel.2021.12.006. Epub 2022 Jan 5. 10.1016/j.devcel.2021.12.006 PubMed 34990589