Skip to main content

pMSCV puro PRDM14 ΔZinc finger domain
(Plasmid #193679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193679 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV puro
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PRDM14
  • Species
    H. sapiens (human)
  • Mutation
    Deletion of Zinc finger domain
  • Entrez Gene
    PRDM14 (a.k.a. PFM11)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV puro PRDM14 ΔZinc finger domain was a gift from William Hahn (Addgene plasmid # 193679 ; http://n2t.net/addgene:193679 ; RRID:Addgene_193679)
  • For your References section:

    YAP1 and PRDM14 converge to promote cell survival and tumorigenesis. Kim M, Ly SH, Xie Y, Duronio GN, Ford-Roshon D, Hwang JH, Sulahian R, Rennhack JP, So J, Gjoerup O, Talamas JA, Grandclaudon M, Long HW, Doench JG, Sethi NS, Giannakis M, Hahn WC. Dev Cell. 2022 Jan 24;57(2):212-227.e8. doi: 10.1016/j.devcel.2021.12.006. Epub 2022 Jan 5. 10.1016/j.devcel.2021.12.006 PubMed 34990589