pO3
(Plasmid
#193748)
-
PurposeExpresses E2-Crimson under the control of PAAH synthetic promoter regulated by AHL and aTc, p15A origin of replication, Chloramphenicol selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepZ
- Backbone size w/o insert (bp) 2158
- Total vector size (bp) 2836
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameE2-Crimson
-
SpeciesBacteria
-
Insert Size (bp)678
- Promoter PAAH
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer TGGATAGCACTGAGAACGTCAT
- 3′ sequencing primer ACCACGGTGTAGTCCTCGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pO3 was a gift from Sangram Bagh (Addgene plasmid # 193748 ; http://n2t.net/addgene:193748 ; RRID:Addgene_193748) -
For your References section:
Distributed Computing with Engineered Bacteria and Its Application in Solving Chemically Generated 2 x 2 Maze Problems. Sarkar K, Chakraborty S, Bonnerjee D, Bagh S. ACS Synth Biol. 2021 Oct 15;10(10):2456-2464. doi: 10.1021/acssynbio.1c00279. Epub 2021 Sep 20. 10.1021/acssynbio.1c00279 PubMed 34543017