Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-TetOn-Cdt1-mCherry
(Plasmid #193760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193760 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-TetOn
  • Backbone size w/o insert (bp) 6532
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdt1-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2385
  • Mutation
    WT
  • Entrez Gene
    CDT1 (a.k.a. DUP, RIS2)
  • Promoter TRE
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagagctcgtttagtgaaccg
  • 3′ sequencing primer cattaaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-TetOn-Cdt1-mCherry was a gift from Tobias Meyer (Addgene plasmid # 193760 ; http://n2t.net/addgene:193760 ; RRID:Addgene_193760)
  • For your References section:

    CDT1 inhibits CMG helicase in early S phase to separate origin licensing from DNA synthesis. Ratnayeke N, Baris Y, Chung M, Yeeles JTP, Meyer T. Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004. 10.1016/j.molcel.2022.12.004 PubMed 36608667