pAAV-CAG-SuperNovaGreen-T2A-dTomato
(Plasmid
#193798)
-
PurposeExpresses SuperNova Green in the cytosol of mammalian cells, joined by a T2A cleavage site with dTomato
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CAG
-
Backbone manufacturerAddgene 51902
- Backbone size w/o insert (bp) 5000
-
Modifications to backboneNone
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuperNova Green
-
SpeciesSynthetic
-
Insert Size (bp)798
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesized by Genscript using amino acid sequence from Addgene 124839
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-SuperNovaGreen-T2A-dTomato was a gift from Xiao Wang (Addgene plasmid # 193798 ; http://n2t.net/addgene:193798 ; RRID:Addgene_193798) -
For your References section:
Optogenetic polymerization and assembly of electrically functional polymers for modulation of single-neuron excitability. Sessler CD, Zhou Y, Wang W, Hartley ND, Fu Z, Graykowski D, Sheng M, Wang X, Liu J. Sci Adv. 2022 Dec 9;8(49):eade1136. doi: 10.1126/sciadv.ade1136. Epub 2022 Dec 7. 10.1126/sciadv.ade1136 PubMed 36475786