Sniper2P
(Plasmid
#193857)
-
PurposeExpresses human codon-optimized Sniper2P and blasticidin resistance: EFS promoter-Sniper2P-NLS-FLAG-P2A-BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
- Total vector size (bp) 12859
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSniper2L
-
Alt nameSniper2L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4641
-
MutationE1007L
- Promoter EFS
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- FLAG (C terminal on insert)
- BSD (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
- 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sniper2P was a gift from Hyongbum Kim (Addgene plasmid # 193857 ; http://n2t.net/addgene:193857 ; RRID:Addgene_193857) -
For your References section:
Sniper2L is a high-fidelity Cas9 variant with high activity. Kim YH, Kim N, Okafor I, Choi S, Min S, Lee J, Bae SM, Choi K, Choi J, Harihar V, Kim Y, Kim JS, Kleinstiver BP, Lee JK, Ha T, Kim HH. Nat Chem Biol. 2023 Mar 9. doi: 10.1038/s41589-023-01279-5. 10.1038/s41589-023-01279-5 PubMed 36894722