DCIP
(Plasmid
#193860)
-
PurposeEncodes SV40-mCherry-GFP1-10 in pDGB1-aR backbone for plant expression. Requires pSOUP for replication in agrobacterium.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB1-a1r
- Backbone size w/o insert (bp) 3196
- Total vector size (bp) 4957
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-mCherry-GFP1-10
-
SpeciesSynthetic
-
Insert Size (bp)1416
- Promoter 35S
-
Tag
/ Fusion Protein
- SV40 NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gggaaacgcctggtatcttt
- 3′ sequencing primer CCGATCCCCGGAATTAGATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Nuclear localized expression of mCherry-GFP1-10 in plants. Transcriptional unit in GoldenBraid pDGB1 alpha1R. Insert can be excised by Esp3I digestion. Requires pSOUP for replication in agrobacterium
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DCIP was a gift from Markita Landry (Addgene plasmid # 193860 ; http://n2t.net/addgene:193860 ; RRID:Addgene_193860) -
For your References section:
Delivered complementation in planta (DCIP) enables measurement of peptide-mediated protein delivery efficiency in plants. Wang JW, Squire HJ, Goh NS, Ni HM, Lien E, Wong C, Gonzalez-Grandio E, Landry MP. Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5. 10.1038/s42003-023-05191-5 PubMed 37573467