Skip to main content

cytoDCIP
(Plasmid #193861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193861 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB1-a1r
  • Backbone size w/o insert (bp) 3196
  • Total vector size (bp) 4933
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-GFP1-10
  • Species
    Synthetic
  • Insert Size (bp)
    1392
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gggaaacgcctggtatcttt
  • 3′ sequencing primer CCGATCCCCGGAATTAGATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cytosolic expression of mCherry-GFP1-10 in plants. Transcriptional unit in GoldenBraid pDGB1 alpha1R. Insert can be excised by Esp3I digestion. Requires pSOUP for replication in agrobacterium

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cytoDCIP was a gift from Markita Landry (Addgene plasmid # 193861 ; http://n2t.net/addgene:193861 ; RRID:Addgene_193861)
  • For your References section:

    Delivered complementation in planta (DCIP) enables measurement of peptide-mediated protein delivery efficiency in plants. Wang JW, Squire HJ, Goh NS, Ni HM, Lien E, Wong C, Gonzalez-Grandio E, Landry MP. Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5. 10.1038/s42003-023-05191-5 PubMed 37573467