Skip to main content

1BR9
(Plasmid #193862)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193862 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    1B
  • Backbone size (bp) 5513
  • Modifications to backbone
    Derived from LIC vector 1B (Addgene Plasmid #29653) with N-Ter HIsxG and C-ter R9.
  • Vector type
    Bacterial Expression
  • Tags / Fusion Proteins
    • Hisx6 (N terminal on backbone)
    • GFP11 (N terminal on backbone)
    • R9 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Derived from Addgene Plasmid #29653.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Add LIC fusion tags to the 5' end of your PCR primers for insert generation.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1BR9 was a gift from Markita Landry (Addgene plasmid # 193862 ; http://n2t.net/addgene:193862 ; RRID:Addgene_193862)
  • For your References section:

    Delivered complementation in planta (DCIP) enables measurement of peptide-mediated protein delivery efficiency in plants. Wang JW, Squire HJ, Goh NS, Ni HM, Lien E, Wong C, Gonzalez-Grandio E, Landry MP. Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5. 10.1038/s42003-023-05191-5 PubMed 37573467