pAAV-CAG-miniSOG
(Plasmid
#193913)
-
PurposeControl plasmid that expresses non-targeted miniSOG in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CAG
-
Backbone manufacturerAddgene 51902
- Backbone size w/o insert (bp) 5000
-
Modifications to backboneNone
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameminiSOG
-
SpeciesSynthetic
-
Insert Size (bp)318
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene 50970
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-miniSOG was a gift from Xiao Wang (Addgene plasmid # 193913 ; http://n2t.net/addgene:193913 ; RRID:Addgene_193913) -
For your References section:
Optogenetic polymerization and assembly of electrically functional polymers for modulation of single-neuron excitability. Sessler CD, Zhou Y, Wang W, Hartley ND, Fu Z, Graykowski D, Sheng M, Wang X, Liu J. Sci Adv. 2022 Dec 9;8(49):eade1136. doi: 10.1126/sciadv.ade1136. Epub 2022 Dec 7. 10.1126/sciadv.ade1136 PubMed 36475786