Skip to main content

pAAV-hSyn-mCherry-T2A-miniSOG-C-Far
(Plasmid #193915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193915 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-hSyn
  • Backbone manufacturer
    Addgene 50970
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5800
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miniSOG
  • Species
    Synthetic
  • Insert Size (bp)
    318
  • Promoter hSyn
  • Tags / Fusion Proteins
    • Flag tag (N terminal on insert)
    • Farnesylation signal sequence (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagtcgtgtcgtgcctgag
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene 50970

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-mCherry-T2A-miniSOG-C-Far was a gift from Xiao Wang (Addgene plasmid # 193915 ; http://n2t.net/addgene:193915 ; RRID:Addgene_193915)
  • For your References section:

    Optogenetic polymerization and assembly of electrically functional polymers for modulation of single-neuron excitability. Sessler CD, Zhou Y, Wang W, Hartley ND, Fu Z, Graykowski D, Sheng M, Wang X, Liu J. Sci Adv. 2022 Dec 9;8(49):eade1136. doi: 10.1126/sciadv.ade1136. Epub 2022 Dec 7. 10.1126/sciadv.ade1136 PubMed 36475786