Skip to main content
Addgene

pAAV-EF1a-NCre-MBP5-WPRE
(Plasmid #193918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193918 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV vector
  • Backbone manufacturer
    Backbone vector is derived from pAAV-EF1a-N-CretrcintG (Connie Cepko, Addgene #69570)
  • Backbone size w/o insert (bp) 5338
  • Total vector size (bp) 6064
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology, Affinity Reagent/ Antibody

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NCre-MBP5
  • Species
    Synthetic
  • Insert Size (bp)
    726
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer gcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone vector is derived from pAAV-EF1a-N-CretrcintG (Connie Cepko, Addgene #69570) and amino acid sequence of MBP is derived from (Fridy, 2014-Nat Methods).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-NCre-MBP5-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 193918 ; http://n2t.net/addgene:193918 ; RRID:Addgene_193918)
  • For your References section:

    Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals. Inutsuka A, Maejima S, Mizoguchi H, Kaneko R, Nomura R, Takanami K, Sakamoto H, Onaka T. Commun Biol. 2022 Sep 16;5(1):979. doi: 10.1038/s42003-022-03944-2. 10.1038/s42003-022-03944-2 PubMed 36114373