Skip to main content

AID-mTagBFP2-loxP_myo2_neoR-loxP
(Plasmid #194055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194055 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    loxP_myo2_neoR
  • Backbone manufacturer
    John Calarco's lab at University of Toronto
  • Vector type
    Worm Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IAA17
  • Alt name
    minimal degron sequence (71-114aa)
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    132
  • Entrez Gene
    AXR3 (a.k.a. AT1G04250, AUXIN RESISTANT 3, AtIAA17, F19P19.31, F19P19_31, IAA17, indole-3-acetic acid inducible 17)
  • Promoter None
  • Tag / Fusion Protein
    • codon optimized mTagBFP2 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 (-41) Forward
  • 3′ sequencing primer pMyo2 ccctcaatgtctctacttgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AID-mTagBFP2-loxP_myo2_neoR-loxP was a gift from Kota Mizumoto (Addgene plasmid # 194055 ; http://n2t.net/addgene:194055 ; RRID:Addgene_194055)
  • For your References section:

    Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. Kurashina M, Mizumoto K. STAR Protoc. 2023 Jan 13;4(1):102028. doi: 10.1016/j.xpro.2022.102028. 10.1016/j.xpro.2022.102028 PubMed 36640369