Skip to main content

pYDE007
(Plasmid #194152)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194152 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWH1266
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 8854
  • Modifications to backbone
    The BamHI-SalI fragment internal to tetA in pWH1266 was replaced with a PCR product having the same restriction sites and J23119, sgRNA, and terminator from pgRNA-bacteria.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Carbenicillin 50 ug/ml can be used
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA with mrfp control guide sequence
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer TCAGGCACCGTGTATGAAATC
  • 3′ sequencing primer TCCTACGAGTTGCATGATAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYDE007 was a gift from Edward Geisinger (Addgene plasmid # 194152 ; http://n2t.net/addgene:194152 ; RRID:Addgene_194152)
  • For your References section:

    Essential Gene Analysis in Acinetobacter baumannii by High-Density Transposon Mutagenesis and CRISPR Interference. Bai J, Dai Y, Farinha A, Tang AY, Syal S, Vargas-Cuebas G, van Opijnen T, Isberg RR, Geisinger E. J Bacteriol. 2021 May 20;203(12):e0056520. doi: 10.1128/JB.00565-20. Epub 2021 Mar 29. 10.1128/JB.00565-20 PubMed 33782056